miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0004706

Located between position 57647578 and 57647667 on chromosome X strand -

Overlapping with sense strand of Atp11c-003 (intron 1).

(Ensemble: OTTMUST00000042675)

mature miRNAs for MI0004706:

mmu-miR-505-5p (MIMAT0017259): GGGAGCCAGGAAGTATTGATGTT

mmu-miR-505-3p (MIMAT0003513): CGTCAACACTTGCTGGTTTTCT

You can find this miRNA in MGI: Mir505 (accession: 3629955)

References

[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"

[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"

[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"