| Basic information from miRBase |
| hairpin accession number: MI0018046 |
| Located between position 24371472 and 24371549 on chromosome 17 strand - |
| Overlapping with sense strand of Ccnf-202 (exon 11). |
| (Ensemble: ENSMUST00000115390) |
| mature miRNAs for MI0018046: |
| mmu-miR-5134 (MIMAT0020645): TTGGCAGAAAGGGCAGCTGTG |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |