miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003206
Located between position 6825528 and 6825623 on chromosome X strand -
Overlapping with sense strand of Clcn5-005 (intron 3).
(Ensemble: OTTMUST00000039777)
mature miRNAs for MI0003206:
         mmu-miR-532-5p (MIMAT0002889): CATGCCTTGAGTGTAGGACCGT
         mmu-miR-532-3p (MIMAT0004781): CCTCCCACACCCAAGGCTTGCA
You can find this miRNA in MGI: Mir532 (accession: 3629950)

References
[1]Lu DP, Read RL, Humphreys DT, Battah FM, Martin DIK, Rasko JEJ, RNAi and Gene Silencing 1:44-49(2005)., "PCR-based expression analysis and identification of microRNAs"
[2]Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H, Nucleic Acids Res. 34:e115(2006)., "Mouse microRNA profiles determined with a new and sensitive cloning method"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[5]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"