| Basic information from miRBase |
| hairpin accession number: MI0005517 |
| Located between position 43640768 and 43640850 on chromosome 16 strand + |
| Overlapping with sense strand of Zbtb20-001 (exon 15). |
| (Ensemble: OTTMUST00000062820) |
| mature miRNAs for MI0005517: |
| mmu-miR-568 (MIMAT0004892): ATGTATAAATGTATACACAC |
| You can find this miRNA in MGI: Mir568 (accession: 3718548) |
| References |
| [1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |