miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004127
Located between position 27886655 and 27886750 on chromosome 6 strand -
Overlapping with sense strand of Grm8-004 (exon 6).
(Ensemble: OTTMUST00000050464)
mature miRNAs for MI0004127:
         mmu-miR-592 (MIMAT0003730): ATTGTGTCAATATGCGATGATGT
         mmu-miR-592* (MIMAT0017234): TCATCACGTGGTGACGCAACAT
You can find this miRNA in MGI: Mir592 (accession: 3629661)

References
[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"
[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"