| Basic information from miRBase |
| hairpin accession number: MI0005083 |
| Located between position 16861483 and 16861554 on chromosome MtChr5 strand + |
| mature miRNAs for MI0005083: |
| mtr-miR395p (MIMAT0003869): TTGAAGCGTTTGGGGGAACTC |
| References |
| [1]Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L, Cell Res. 15:631-638(2005)., "Molecular evolution of the rice miR395 gene family" |