| Basic information from miRBase |
| hairpin accession number: MI0010541 |
| Located between position 35585795 and 35585938 on chromosome MtChr8 strand + |
| mature miRNAs for MI0010541: |
| mtr-miR1507* (MIMAT0010030): AGAGTTGTATGGAACGAAAGAT |
| mtr-miR1507 (MIMAT0010031): CCTCGTTCCATACATCATCTAG |
| References |
| [1]Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T, BMC Genomics. 9:593(2008)., "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" |
| [2]Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R, New Phytol. 184:85-98(2009)., "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" |