miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010698
mature miRNAs for MI0010698:
         mtr-miR2119 (MIMAT0011168): TCAAAGGGAGGTGTGGAGTAG

References
[1]Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL, Plant Mol Biol. 70:385-401(2009)., "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress"
[2]Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R, New Phytol. 184:85-98(2009)., "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"
[3]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"