miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0016923
mature miRNAs for MI0016923:
         oar-miR-323a-5p (MIMAT0019259): AGGTGGTCCGTGGCGCGTTCG
         oar-miR-323a-3p (MIMAT0019260): CACATTACACGGTCGACCTCT

References
[1]Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D, Genome Res. 20:1651-1662(2010)., "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing"