| Basic information from miRBase |
| hairpin accession number: MI0001092 |
| Located between position 17680877 and 17681148 on chromosome 01 strand + |
| mature miRNAs for MI0001092: |
| osa-miR159a.2 (MIMAT0009200): TTGCATGCCCCAGGAGCTGCA |
| osa-miR159a.1 (MIMAT0001022): TTTGGATTGAAGGGAGCTCTG |
| References |
| [1]Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" |
| [2]Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M, BMC Plant Biol. 8:123(2008)., "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" |