| Basic information from miRBase |
| hairpin accession number: MI0011266 |
| Located between position 7803178 and 7803351 on chromosome 11 strand - |
| mature miRNAs for MI0011266: |
| osa-miR2118p (MIMAT0011755): TTCCCGATGCCTCCCATGCCTA |
| References |
| [1]Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH, Genome Res. 19:1429-1440(2009)., "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" |