| Basic information from miRBase |
| hairpin accession number: MI0011268 |
| Located between position 7805968 and 7806142 on chromosome 11 strand - |
| mature miRNAs for MI0011268: |
| osa-miR2118r (MIMAT0011757): TTCCCAATGCCTCCCATGCCTA |
| References |
| [1]Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH, Genome Res. 19:1429-1440(2009)., "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" |