miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011178
Located between position 57887 and 57976 on chromosome Ppa_Contig184 strand -
mature miRNAs for MI0011178:
         ppc-miR-2235 (MIMAT0011681): TCACCGGGAGCATTGTATGATC

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"