miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011170
Located between position 883010 and 883110 on chromosome Ppa_Contig28 strand -
mature miRNAs for MI0011170:
         ppc-miR-63e (MIMAT0011677): TATGACGTAGAAGCGAGTGAAG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"