| Basic information from miRBase |
| hairpin accession number: MI0004729 |
| Located between position 204264 and 204398 on chromosome scaffold_264 strand - |
| mature miRNAs for MI0004729: |
| ppt-miR390c (MIMAT0003919): GAGCTCAGGAGGGATAGCGCC |
| ppt-miR390c* (MIMAT0004327): CGCTGTCCATTCTGAGCATTG |
| References |
| [1]Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T, Plant J. 47:25-37(2006)., "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" |
| [2]Fattash I, Voss B, Reski R, Hess WR, Frank W, BMC Plant Biol. 7:13(2007)., "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" |
| [3]Axtell MJ, Snyder JA, Bartel DP, Plant Cell. 19:1750-1769(2007)., "Common functions for diverse small RNAs of land plants" |