| Basic information from miRBase |
| hairpin accession number: MI0005672 |
| Located between position 477499 and 477583 on chromosome scaffold_242 strand + |
| mature miRNAs for MI0005672: |
| ppt-miR477a-5p (MIMAT0004360): CTCTCCCTCAAAGGCTTCCA |
| ppt-miR477a-3p (MIMAT0003899): AGAAGCCTTTGTGGGAGAGGA |
| References |
| [1]Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T, Plant J. 47:25-37(2006)., "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss" |
| [2]Fattash I, Voss B, Reski R, Hess WR, Frank W, BMC Plant Biol. 7:13(2007)., "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" |
| [3]Axtell MJ, Snyder JA, Bartel DP, Plant Cell. 19:1750-1769(2007)., "Common functions for diverse small RNAs of land plants" |