miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005674
Located between position 298272 and 298399 on chromosome scaffold_275 strand +
mature miRNAs for MI0005674:
         ppt-miR477g-5p (MIMAT0004362): TCCCTCAAAGGCTTCCAACAA
         ppt-miR477g-3p (MIMAT0003902): GTTGGAAGCCTTCGTGGGAGA

References
[1]Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T, Plant J. 47:25-37(2006)., "Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss"
[2]Fattash I, Voss B, Reski R, Hess WR, Frank W, BMC Plant Biol. 7:13(2007)., "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
[3]Axtell MJ, Snyder JA, Bartel DP, Plant Cell. 19:1750-1769(2007)., "Common functions for diverse small RNAs of land plants"