miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005794
mature miRNAs for MI0005794:
         pta-miR946a* (MIMAT0006791): TGTGGATAGAGAAGGGTTAGT
         pta-miR946a (MIMAT0005005): CAGCCCTTCTCCTATCCACAA

References
[1]Lu S, Sun YH, Amerson H, Chiang VL, Plant J. 51:1077-1098(2007)., "MicroRNAs in loblolly pine (Pinus taeda L.) and their association with fusiform rust gall development"
[2]Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ, Genome Res. 18:571-584(2008)., "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa"