| Basic information from miRBase |
| hairpin accession number: MI0008440 |
| Located between position 63121557 and 63121640 on chromosome 1 strand + |
| Overlapping with sense strand of XM_513449.2 (intron 28). |
| (Ensemble: ENSPTRT00000001528) |
| mature miRNAs for MI0008440: |
| ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
| You can find this miRNA in ENTREZGENE: MIR1244-1 (accession: 100316055) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |