miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008442
Located between position 12509127 and 12509210 on chromosome 12 strand +
Overlapping with sense strand of (intron 4).
(Ensemble: ENSPTRT00000008693)
mature miRNAs for MI0008442:
         ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT
You can find this miRNA in ENTREZGENE: MIR1244-3 (accession: 100316311)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"