Basic information from miRBase |
hairpin accession number: MI0008442 |
Located between position 12509127 and 12509210 on chromosome 12 strand + |
Overlapping with sense strand of (intron 4). |
(Ensemble: ENSPTRT00000008693) |
mature miRNAs for MI0008442: |
ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
You can find this miRNA in ENTREZGENE: MIR1244-3 (accession: 100316311) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |