miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008443
Located between position 9568581 and 9568664 on chromosome 12 strand -
mature miRNAs for MI0008443:
         ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT
You can find this miRNA in ENTREZGENE: MIR1244-4 (accession: 100316056)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"