Basic information from miRBase |
hairpin accession number: MI0008444 |
Located between position 49487187 and 49487270 on chromosome 12 strand + |
mature miRNAs for MI0008444: |
ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
You can find this miRNA in ENTREZGENE: MIR1244-5 (accession: 100316366) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |