miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008445
Located between position 237940030 and 237940113 on chromosome 2b strand +
Overlapping with sense strand of XR_021184.1 (exon 5).
(Ensemble: ENSPTRT00000044582) RefSeq_dna: RefSeq)
mature miRNAs for MI0008445:
         ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT
You can find this miRNA in ENTREZGENE: MIR1244-6 (accession: 100316057)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"