| Basic information from miRBase |
| hairpin accession number: MI0008445 |
| Located between position 237940030 and 237940113 on chromosome 2b strand + |
| Overlapping with sense strand of XR_021184.1 (exon 5). |
| (Ensemble: ENSPTRT00000044582) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0008445: |
| ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
| You can find this miRNA in ENTREZGENE: MIR1244-6 (accession: 100316057) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |