| Basic information from miRBase |
| hairpin accession number: MI0008447 |
| Located between position 3433935 and 3434018 on chromosome 3_random strand - |
| mature miRNAs for MI0008447: |
| ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
| You can find this miRNA in ENTREZGENE: MIR1244-8 (accession: 100316058) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |