miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008448
Located between position 120365430 and 120365513 on chromosome 5 strand +
Overlapping with antisense strand of XR_021521.1 (intron 1).
(Ensemble: ENSPTRT00000031778) RefSeq_dna: RefSeq)
mature miRNAs for MI0008448:
         ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT
You can find this miRNA in ENTREZGENE: MIR1244-9 (accession: 100316312)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"