Basic information from miRBase |
hairpin accession number: MI0008448 |
Located between position 120365430 and 120365513 on chromosome 5 strand + |
Overlapping with antisense strand of XR_021521.1 (intron 1). |
(Ensemble: ENSPTRT00000031778) RefSeq_dna: RefSeq) |
mature miRNAs for MI0008448: |
ptr-miR-1244 (MIMAT0007970): AAGTAGTTGGTTTGTATGAGATGGTT |
You can find this miRNA in ENTREZGENE: MIR1244-9 (accession: 100316312) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |