Basic information from miRBase |
hairpin accession number: MI0008451 |
Located between position 194250137 and 194250205 on chromosome 2b strand + |
Overlapping with sense strand of XM_001163555.1 (intron 1). |
(Ensemble: ENSPTRT00000023591) |
mature miRNAs for MI0008451: |
ptr-miR-1245 (MIMAT0007971): AAGTGATCTAAAGGCCTACAT |
You can find this miRNA in ENTREZGENE: MIR1245 (accession: 100316060) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |