| Basic information from miRBase |
| hairpin accession number: MI0008453 |
| Located between position 102002334 and 102002468 on chromosome 14 strand - |
| mature miRNAs for MI0008453: |
| ptr-miR-1247 (MIMAT0007973): ACCCGTCCCGTTCGTCCCCGGA |
| You can find this miRNA in ENTREZGENE: MIR1247 (accession: 100316061) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |