miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008454
Located between position 192369084 and 192369188 on chromosome 3 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSPTRT00000072174)
mature miRNAs for MI0008454:
         ptr-miR-1248 (MIMAT0007974): ACCTTCTTGTATAAGCACTGTGCTAAA
You can find this miRNA in ENTREZGENE: MIR1248 (accession: 100316411)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"