| Basic information from miRBase |
| hairpin accession number: MI0008455 |
| Located between position 44356583 and 44356647 on chromosome 22 strand - |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSPTRT00000050787) |
| mature miRNAs for MI0008455: |
| ptr-miR-1249 (MIMAT0007975): ACGCCCTTCCCCCCCTTCTTCA |
| You can find this miRNA in ENTREZGENE: MIR1249 (accession: 100316062) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |