miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008455
Located between position 44356583 and 44356647 on chromosome 22 strand -
Overlapping with sense strand of (intron 6).
(Ensemble: ENSPTRT00000050787)
mature miRNAs for MI0008455:
         ptr-miR-1249 (MIMAT0007975): ACGCCCTTCCCCCCCTTCTTCA
You can find this miRNA in ENTREZGENE: MIR1249 (accession: 100316062)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"