miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008457
Located between position 98509213 and 98509281 on chromosome 12 strand +
mature miRNAs for MI0008457:
         ptr-miR-1251 (MIMAT0007977): ACTCTAGCTGCCAAAGGCGCT
You can find this miRNA in ENTREZGENE: MIR1251 (accession: 100316431)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"