| Basic information from miRBase |
| hairpin accession number: MI0008457 |
| Located between position 98509213 and 98509281 on chromosome 12 strand + |
| mature miRNAs for MI0008457: |
| ptr-miR-1251 (MIMAT0007977): ACTCTAGCTGCCAAAGGCGCT |
| You can find this miRNA in ENTREZGENE: MIR1251 (accession: 100316431) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |