Basic information from miRBase |
hairpin accession number: MI0008458 |
Located between position 2748059 and 2748162 on chromosome 17 strand - |
mature miRNAs for MI0008458: |
ptr-miR-1253 (MIMAT0007978): AGAGAAGAAGATCAGCCTGCA |
You can find this miRNA in ENTREZGENE: MIR1253 (accession: 100316367) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |