miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008458
Located between position 2748059 and 2748162 on chromosome 17 strand -
mature miRNAs for MI0008458:
         ptr-miR-1253 (MIMAT0007978): AGAGAAGAAGATCAGCCTGCA
You can find this miRNA in ENTREZGENE: MIR1253 (accession: 100316367)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"