Basic information from miRBase |
hairpin accession number: MI0008459 |
Located between position 67784919 and 67785014 on chromosome 10 strand + |
Overlapping with sense strand of XM_001168515.1 (intron 15). |
(Ensemble: ENSPTRT00000004800) |
mature miRNAs for MI0008459: |
ptr-miR-1254 (MIMAT0007979): AGCCTGGAAGCTGGAGCCTGCAGT |
You can find this miRNA in ENTREZGENE: MIR1254 (accession: 100316064) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |