| Basic information from miRBase |
| hairpin accession number: MI0008459 |
| Located between position 67784919 and 67785014 on chromosome 10 strand + |
| Overlapping with sense strand of XM_001168515.1 (intron 15). |
| (Ensemble: ENSPTRT00000004800) |
| mature miRNAs for MI0008459: |
| ptr-miR-1254 (MIMAT0007979): AGCCTGGAAGCTGGAGCCTGCAGT |
| You can find this miRNA in ENTREZGENE: MIR1254 (accession: 100316064) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |