miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008459
Located between position 67784919 and 67785014 on chromosome 10 strand +
Overlapping with sense strand of XM_001168515.1 (intron 15).
(Ensemble: ENSPTRT00000004800)
mature miRNAs for MI0008459:
         ptr-miR-1254 (MIMAT0007979): AGCCTGGAAGCTGGAGCCTGCAGT
You can find this miRNA in ENTREZGENE: MIR1254 (accession: 100316064)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"