Basic information from miRBase |
hairpin accession number: MI0008460 |
Located between position 147366312 and 147366377 on chromosome 1 strand + |
Overlapping with sense strand of XM_001174778.1 (intron 7). |
(Ensemble: ENSPTRT00000065051) |
mature miRNAs for MI0008460: |
ptr-miR-1255b (MIMAT0007980): CGGATGAGCAAAGAAAGTGGTT |
You can find this miRNA in ENTREZGENE: MIR1255B (accession: 100316518) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |