| Basic information from miRBase |
| hairpin accession number: MI0008460 |
| Located between position 147366312 and 147366377 on chromosome 1 strand + |
| Overlapping with sense strand of XM_001174778.1 (intron 7). |
| (Ensemble: ENSPTRT00000065051) |
| mature miRNAs for MI0008460: |
| ptr-miR-1255b (MIMAT0007980): CGGATGAGCAAAGAAAGTGGTT |
| You can find this miRNA in ENTREZGENE: MIR1255B (accession: 100316518) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |