| Basic information from miRBase |
| hairpin accession number: MI0008462 |
| Located between position 184912325 and 184912396 on chromosome 2b strand - |
| mature miRNAs for MI0008462: |
| ptr-miR-1258 (MIMAT0007982): AGTTAGGATTAGGTCGTGGAA |
| You can find this miRNA in ENTREZGENE: MIR1258 (accession: 100316066) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |