miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008462
Located between position 184912325 and 184912396 on chromosome 2b strand -
mature miRNAs for MI0008462:
         ptr-miR-1258 (MIMAT0007982): AGTTAGGATTAGGTCGTGGAA
You can find this miRNA in ENTREZGENE: MIR1258 (accession: 100316066)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"