| Basic information from miRBase |
| hairpin accession number: MI0008467 |
| Located between position 169270885 and 169270969 on chromosome 3 strand - |
| mature miRNAs for MI0008467: |
| ptr-miR-1263 (MIMAT0007987): ATGGTACCCTGGCATACTGAGT |
| You can find this miRNA in ENTREZGENE: MIR1263 (accession: 100316069) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |