| Basic information from miRBase |
| hairpin accession number: MI0008469 |
| Located between position 14810110 and 14810177 on chromosome 10 strand + |
| mature miRNAs for MI0008469: |
| ptr-miR-1265 (MIMAT0007989): CAGGATGTGGTCAAGTGTTGTT |
| You can find this miRNA in ENTREZGENE: MIR1265 (accession: 100316433) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |