| Basic information from miRBase |
| hairpin accession number: MI0008470 |
| Located between position 49597881 and 49597963 on chromosome 15 strand - |
| Overlapping with sense strand of XM_510411.2 (intron 3). |
| (Ensemble: ENSPTRT00000013074) |
| mature miRNAs for MI0008470: |
| ptr-miR-1266 (MIMAT0007990): CCTCAGGGCTGTAGAACAGGGCT |
| You can find this miRNA in ENTREZGENE: MIR1266 (accession: 100316070) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |