Basic information from miRBase |
hairpin accession number: MI0008471 |
Located between position 108544362 and 108544438 on chromosome 13 strand - |
Overlapping with sense strand of XM_509725.2 (intron 1). |
(Ensemble: ENSPTRT00000060071) |
mature miRNAs for MI0008471: |
ptr-miR-1267 (MIMAT0007991): CCTGTTGAAGTGTAATCCCCA |
You can find this miRNA in ENTREZGENE: MIR1267 (accession: 100316071) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |