| Basic information from miRBase |
| hairpin accession number: MI0008472 |
| Located between position 178718381 and 178718465 on chromosome 5 strand + |
| Overlapping with sense strand of XM_001135654.1 (intron 2). |
| (Ensemble: ENSPTRT00000032452) |
| mature miRNAs for MI0008472: |
| ptr-miR-1271 (MIMAT0007992): CTTGGCACCTAGCAAGCACTCA |
| You can find this miRNA in ENTREZGENE: MIR1271 (accession: 100316314) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |