| Basic information from miRBase |
| hairpin accession number: MI0008477 |
| Located between position 83417156 and 83417237 on chromosome 15 strand - |
| Overlapping with sense strand of XM_510571.2 (intron 1). |
| (Ensemble: ENSPTRT00000013668) |
| mature miRNAs for MI0008477: |
| ptr-miR-1276 (MIMAT0007997): TAAAGAGCCCTGTGGAGACA |
| You can find this miRNA in ENTREZGENE: MIR1276 (accession: 100316074) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |