| Basic information from miRBase |
| hairpin accession number: MI0008478 |
| Located between position 172941910 and 172941989 on chromosome 1 strand + |
| Overlapping with sense strand of XM_001167188.1 (intron 5). |
| (Ensemble: ENSPTRT00000003260) |
| mature miRNAs for MI0008478: |
| ptr-miR-1278 (MIMAT0007998): TAGTACTGTGCATATCATCT |
| You can find this miRNA in ENTREZGENE: MIR1278 (accession: 100316315) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |