| Basic information from miRBase |
| hairpin accession number: MI0008485 |
| Located between position 73399139 and 73399257 on chromosome 3 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000028257) |
| mature miRNAs for MI0008485: |
| ptr-miR-1284 (MIMAT0008003): TCTATACAGACCCTGGCTTTTC |
| You can find this miRNA in ENTREZGENE: MIR1284 (accession: 100316436) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |