miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000834
Located between position 41376943 and 41377025 on chromosome X strand +
Overlapping with sense strand of (intron 68).
(Ensemble: ENSRNOT00000004064)
mature miRNAs for MI0000834:
         rno-let-7f (MIMAT0000778): TGAGGTAGTAGATTGTATAGTT
         rno-let-7f-2* (MIMAT0017090): CTATACAGTCTACTGTCTTTC
You can find this miRNA in ENTREZGENE: Mirlet7f-2 (accession: 100313992)

References
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[2]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4]He X, Zhang Q, Liu Y, Pan X, Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007)., "Cloning and identification of novel microRNAs from rat hippocampus"
[5]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"