miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000841

Located between position 85049314 and 85049423 on chromosome 10 strand +

mature miRNAs for MI0000841:

rno-miR-10a-5p (MIMAT0000782): TACCCTGTAGATCCGAATTTGTG

rno-miR-10a-3p (MIMAT0004709): CAAATTCGTATCTAGGGGAATA

You can find this miRNA in ENTREZGENE: Mir10a (accession: 100313996)

References

[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"

[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[3]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"