| Basic information from miRBase |
| hairpin accession number: MI0000842 |
| Located between position 57340853 and 57340961 on chromosome 3 strand + |
| Overlapping with sense strand of Hoxd4 (intron 4). |
| (Ensemble: ENSRNOT00000002145) (RGD: RGD) |
| mature miRNAs for MI0000842: |
| rno-miR-10b (MIMAT0000783): CCCTGTAGAACCGAATTTGTGT |
| rno-miR-10b* (MIMAT0017092): ACAGATTCGATTCTAGGGGAA |
| You can find this miRNA in ENTREZGENE: Mir10b (accession: 100314226) |
| References |
| [1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |