miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000842
Located between position 57340853 and 57340961 on chromosome 3 strand +
Overlapping with sense strand of Hoxd4 (intron 4).
(Ensemble: ENSRNOT00000002145) (RGD: RGD)
mature miRNAs for MI0000842:
         rno-miR-10b (MIMAT0000783): CCCTGTAGAACCGAATTTGTGT
         rno-miR-10b* (MIMAT0017092): ACAGATTCGATTCTAGGGGAA
You can find this miRNA in ENTREZGENE: Mir10b (accession: 100314226)

References
[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"