miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000856

Located between position 17607970 and 17608053 on chromosome 12 strand -

Overlapping with sense strand of Mcm7 (intron 12).

(Ensemble: ENSRNOT00000001825) (RGD: RGD)

mature miRNAs for MI0000856:

rno-miR-25* (MIMAT0004713): AGGCGGAGACACGGGCAATTGC

rno-miR-25 (MIMAT0000795): CATTGCACTTGTCTCGGTCTGA

You can find this miRNA in ENTREZGENE: Mir25 (accession: 100314004)

References

[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"

[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[3]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"