miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000860

Located between position 25638578 and 25638664 on chromosome 19 strand -

mature miRNAs for MI0000860:

rno-miR-27a* (MIMAT0004715): AGGGCTTAGCTGCTTGTGAGCA

rno-miR-27a (MIMAT0000799): TTCACAGTGGCTAAGTTCCGC

You can find this miRNA in ENTREZGENE: Mir27a (accession: 100314006)

References

[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"

[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[3]He X, Zhang Q, Liu Y, Pan X, Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007)., "Cloning and identification of novel microRNAs from rat hippocampus"

[4]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"