| Basic information from miRBase |
| hairpin accession number: MI0000872 |
| Located between position 108497649 and 108497754 on chromosome 5 strand - |
| mature miRNAs for MI0000872: |
| rno-miR-31 (MIMAT0000810): AGGCAAGATGCTGGCATAGCTG |
| rno-miR-31* (MIMAT0017102): TGCTATGCCAACATATTGCCATC |
| You can find this miRNA in ENTREZGENE: Mir31 (accession: 100314232) |
| References |
| [1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |