miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000636
Located between position 127468167 and 127468263 on chromosome 7 strand -
Overlapping with sense strand of D4A3X4_RAT (exon 5).
(Ensemble: ENSRNOT00000030866)
mature miRNAs for MI0000636:
         rno-miR-349 (MIMAT0000599): CAGCCCTGCTGTCTTAACCTCT
You can find this miRNA in ENTREZGENE: Mir349 (accession: 100313983)

References
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"


more data
Polymorphism data from Patrocles