Basic information from miRBase |
hairpin accession number: MI0000636 |
Located between position 127468167 and 127468263 on chromosome 7 strand - |
Overlapping with sense strand of D4A3X4_RAT (exon 5). |
(Ensemble: ENSRNOT00000030866) |
mature miRNAs for MI0000636: |
rno-miR-349 (MIMAT0000599): CAGCCCTGCTGTCTTAACCTCT |
You can find this miRNA in ENTREZGENE: Mir349 (accession: 100313983) |
References |
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" |
more data |
Polymorphism data from Patrocles |