| Basic information from miRBase |
| hairpin accession number: MI0000876 |
| Located between position 54422052 and 54422128 on chromosome 8 strand - |
| mature miRNAs for MI0000876: |
| rno-miR-34c (MIMAT0000814): AGGCAGTGTAGTTAGCTGATTGC |
| rno-miR-34c* (MIMAT0004723): AATCACTAACCACACAGCCAGG |
| You can find this miRNA in ENTREZGENE: Mir34c (accession: 100314014) |
| References |
| [1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |